Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 4906324
End position: 4906383
Length: 60

DNA sequence
>NC_017729, from 4906324 to 4906383 (60 bp); Bacillus anthracis str. H9401 TATCTTCTTTTTTAGGTGCTTCTTTTTTAGGCTCTTCCTTTTTAGGCTCTTCTTTTTGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4905948-4907258	Sequence	H9401_5176 - N-acetylmuramoyl-L-alanine amidase (Protein is coded in complementary strand; from 4907258 to 4905948)