Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 5023078
End position: 5023101
Length: 24

DNA sequence
>NC_017729, from 5023078 to 5023101 (24 bp); Bacillus anthracis str. H9401 GCCTTCGCTTTCGCTTTCGCCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5022412-5023467	Sequence	H9401_5284 - NADH dehydrogenase i, subunit c (Protein is coded in complementary strand; from 5023467 to 5022412)