Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 5136712
End position: 5136736
Length: 25

DNA sequence
>NC_017729, from 5136712 to 5136736 (25 bp); Bacillus anthracis str. H9401 TTTCTTCTCTTTTATATTCTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5136605-5137186	Sequence	H9401_5404 - Two-component sensor protein (Protein is coded in complementary strand; from 5137186 to 5136605)