Sequence retrieval

Genome: Bacillus anthracis str. H9401
Start position: 742219
End position: 742242
Length: 24

DNA sequence
>NC_017729, from 742219 to 742242 (24 bp); Bacillus anthracis str. H9401 TGTTTGAGTTTGTGATTGCGTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 741803-742963	Sequence	H9401_0693 - Peptidase, M23/M37 family (Protein is coded in complementary strand; from 742963 to 741803)