Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 1661668
End position: 1661691
Length: 24

DNA sequence
>NC_017731, from 1661668 to 1661691 (24 bp); Providencia stuartii MRSN 2154 CACCAGCAGCAGTACCAGCAGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1661310-1662656	Sequence	S70_07835 - hypothetical protein (Protein is coded in complementary strand; from 1662656 to 1661310)