Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 1960991
End position: 1961014
Length: 24

DNA sequence
>NC_017731, from 1960991 to 1961014 (24 bp); Providencia stuartii MRSN 2154 ATCTTCGTCTTCTTCTTCATCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1960953-1961279	Sequence	S70_09150 - GTPase activator (Protein is coded in complementary strand; from 1961279 to 1960953)