Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 2391512
End position: 2391538
Length: 27

DNA sequence
>NC_017731, from 2391512 to 2391538 (27 bp); Providencia stuartii MRSN 2154 CATCAAATTCATCATATTCATTAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2391019-2391681	Sequence	S70_11150 - hypothetical protein (Protein is coded in complementary strand; from 2391681 to 2391019)