Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 261753
End position: 261776
Length: 24

DNA sequence
>NC_017731, from 261753 to 261776 (24 bp); Providencia stuartii MRSN 2154 ATCAAAATCACAATCAAGATCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 261627-263009	Sequence	S70_01315 - aromatic amino acid transport protein AroP (Protein is coded in complementary strand; from 263009 to 261627)