Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 2907431
End position: 2907466
Length: 36

DNA sequence
>NC_017731, from 2907431 to 2907466 (36 bp); Providencia stuartii MRSN 2154 CATGCCTTCTATCTTGCCTTCTATCTTACCTTCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2907297-2908262	Sequence	S70_13645 - transposase (Protein is coded in complementary strand; from 2908262 to 2907297)