Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 3078719
End position: 3078748
Length: 30

DNA sequence
>NC_017731, from 3078719 to 3078748 (30 bp); Providencia stuartii MRSN 2154 TCATCTTCGTCTTCATCGTCGTCTTTATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3077471-3079324	Sequence	S70_14515 - RNA polymerase sigma factor RpoD (Protein is coded in complementary strand; from 3079324 to 3077471)