Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 3652045
End position: 3652068
Length: 24

DNA sequence
>NC_017731, from 3652045 to 3652068 (24 bp); Providencia stuartii MRSN 2154 CTGCTACTGCCACTGCTACTGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3651012-3652085	Sequence	S70_17310 - outer membrane protein A (Protein is coded in complementary strand; from 3652085 to 3651012)