Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 3908224
End position: 3908247
Length: 24

DNA sequence
>NC_017731, from 3908224 to 3908247 (24 bp); Providencia stuartii MRSN 2154 TGTGATTGCGATTTTGATGGTGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3906819-3908294	Sequence	S70_18590 tppB putative tripeptide transporter permease