Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 3933175
End position: 3933210
Length: 36

DNA sequence
>NC_017731, from 3933175 to 3933210 (36 bp); Providencia stuartii MRSN 2154 TACAGAGATTACTACAGAGACTACTACAGAGATTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3932610-3933554	Sequence	S70_18735 - putative replication protein from phage (modular protein)