Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 614482
End position: 614517
Length: 36

DNA sequence
>NC_017731, from 614482 to 614517 (36 bp); Providencia stuartii MRSN 2154 TGCCTTTTTCAATACCTTTTTCAATGCCTTTTTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 614370-615332	Sequence	S70_02970 - transposase (Protein is coded in complementary strand; from 615332 to 614370)