Sequence retrieval

Genome: Providencia stuartii MRSN 2154
Start position: 962739
End position: 962774
Length: 36

DNA sequence
>NC_017731, from 962739 to 962774 (36 bp); Providencia stuartii MRSN 2154 AATATTCTCTGTAGTAATCTCTGTAGTAATCTCTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 962404-963336	Sequence	S70_04620 - putative replication protein from phage (modular protein) (Protein is coded in complementary strand; from 963336 to 962404)