Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 1026580
End position: 1026606
Length: 27

DNA sequence
>NC_017904, from 1026580 to 1026606 (27 bp); Mycobacterium sp. MOTT36Y GATCCGAGCGATCCGATCGATCCGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1026325-1027560	Sequence	W7S_05085 - hypothetical protein (Protein is coded in complementary strand; from 1027560 to 1026325)