Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 1341686
End position: 1341709
Length: 24

DNA sequence
>NC_017904, from 1341686 to 1341709 (24 bp); Mycobacterium sp. MOTT36Y TGGCGATCGCGATCGCGATGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1340362-1342197	Sequence	W7S_06455 - ABC transporter, ATP-binding protein OppD (Protein is coded in complementary strand; from 1342197 to 1340362)