Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 1575707
End position: 1575736
Length: 30

DNA sequence
>NC_017904, from 1575707 to 1575736 (30 bp); Mycobacterium sp. MOTT36Y GTCGCCGACGCCGTCGCCGTCGCTGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1574232-1575797	Sequence	W7S_07475 - alpha-amylase family protein (Protein is coded in complementary strand; from 1575797 to 1574232)