Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 1836676
End position: 1836699
Length: 24

DNA sequence
>NC_017904, from 1836676 to 1836699 (24 bp); Mycobacterium sp. MOTT36Y CGGGCGCGGGAGCGAGCGCGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1836661-1837302	Sequence	W7S_08595 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 1837302 to 1836661)