Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 2109335
End position: 2109379
Length: 45

DNA sequence
>NC_017904, from 2109335 to 2109379 (45 bp); Mycobacterium sp. MOTT36Y GGACCACCAGGACCACCGGGACCGCCAGGACCGCCAGGACCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2108924-2109499	Sequence	W7S_09725 - chitin-binding protein (Protein is coded in complementary strand; from 2109499 to 2108924)