Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 2218989
End position: 2219013
Length: 25

DNA sequence
>NC_017904, from 2218989 to 2219013 (25 bp); Mycobacterium sp. MOTT36Y GCGCCGCGGCGCACCACGCCGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2218593-2220014	Sequence	W7S_10235 - propionyl-CoA carboxylase subunit beta (Protein is coded in complementary strand; from 2220014 to 2218593)