Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 229645
End position: 229668
Length: 24

DNA sequence
>NC_017904, from 229645 to 229668 (24 bp); Mycobacterium sp. MOTT36Y CGCCGCCGCCTCGGCCGCCGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 229337-229795	Sequence	W7S_01115 - FHA domain-containing protein (Protein is coded in complementary strand; from 229795 to 229337)