Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 2304768
End position: 2304803
Length: 36

DNA sequence
>NC_017904, from 2304768 to 2304803 (36 bp); Mycobacterium sp. MOTT36Y GGTCGAGCCGTTGGTCGAACCGTTCGTCGAACCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2304754-2306457	Sequence	W7S_10670 - cytochrome b6 (Protein is coded in complementary strand; from 2306457 to 2304754)