Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 2458043
End position: 2458066
Length: 24

DNA sequence
>NC_017904, from 2458043 to 2458066 (24 bp); Mycobacterium sp. MOTT36Y CGGCGACTGCGACGGCGGCGGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2457144-2458211	Sequence	W7S_11380 - LppL protein (Protein is coded in complementary strand; from 2458211 to 2457144)