Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 2646150
End position: 2646173
Length: 24

DNA sequence
>NC_017904, from 2646150 to 2646173 (24 bp); Mycobacterium sp. MOTT36Y CGCCGGCGCTGGCGCCGCCGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2645702-2646628	Sequence	W7S_12105 - alpha/beta hydrolase domain-containing protein (Protein is coded in complementary strand; from 2646628 to 2645702)