Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 2895644
End position: 2895667
Length: 24

DNA sequence
>NC_017904, from 2895644 to 2895667 (24 bp); Mycobacterium sp. MOTT36Y GCGGCGGCGCCGGTGGCGGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2894479-2896302	Sequence	W7S_13335 - hypothetical protein (Protein is coded in complementary strand; from 2896302 to 2894479)