Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 2902485
End position: 2902514
Length: 30

DNA sequence
>NC_017904, from 2902485 to 2902514 (30 bp); Mycobacterium sp. MOTT36Y TCGACGTCGAAGTCGAGGTCGAGGTCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2901989-2903215	Sequence	W7S_13370 - hypothetical protein (Protein is coded in complementary strand; from 2903215 to 2901989)