Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 302181
End position: 302204
Length: 24

DNA sequence
>NC_017904, from 302181 to 302204 (24 bp); Mycobacterium sp. MOTT36Y GGCGTCGGCGCCGGCGTAGGCGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 301372-304755	Sequence	W7S_01465 - pyruvate carboxylase (Protein is coded in complementary strand; from 304755 to 301372)