Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3043272
End position: 3043301
Length: 30

DNA sequence
>NC_017904, from 3043272 to 3043301 (30 bp); Mycobacterium sp. MOTT36Y CTCGCCGCCGGTGGCCGCCGACCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3042871-3044661	Sequence	W7S_14015 - gnat-family protein acetyltransferase (Protein is coded in complementary strand; from 3044661 to 3042871)