Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3489736
End position: 3489759
Length: 24

DNA sequence
>NC_017904, from 3489736 to 3489759 (24 bp); Mycobacterium sp. MOTT36Y GCACCACCACCAGCAGCAGCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3489498-3489932	Sequence	W7S_15540 - nodulation efficiency protein D (NfeD) (Protein is coded in complementary strand; from 3489932 to 3489498)