Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 373187
End position: 373211
Length: 25

DNA sequence
>NC_017904, from 373187 to 373211 (25 bp); Mycobacterium sp. MOTT36Y CCGAACCGCACCGAGCCGGACCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 372524-373522	Sequence	W7S_01800 - hypothetical protein (Protein is coded in complementary strand; from 373522 to 372524)