Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3823975
End position: 3824019
Length: 45

DNA sequence
>NC_017904, from 3823975 to 3824019 (45 bp); Mycobacterium sp. MOTT36Y GGATACTCGTCGTCGGCGTACTCGTCGTCCGGATAGCCGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3823504-3825720	Sequence	W7S_17225 - hypothetical protein (Protein is coded in complementary strand; from 3825720 to 3823504)