Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3847190
End position: 3847213
Length: 24

DNA sequence
>NC_017904, from 3847190 to 3847213 (24 bp); Mycobacterium sp. MOTT36Y TCGTCGTCGTAGTCCTCGTCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3845438-3847756	Sequence	W7S_17345 - ftsK/SpoIIIE family protein (Protein is coded in complementary strand; from 3847756 to 3845438)