Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3880208
End position: 3880247
Length: 40

DNA sequence
>NC_017904, from 3880208 to 3880247 (40 bp); Mycobacterium sp. MOTT36Y GGCTAATCGGCTAATCGGCTAATCGGCTAATCGGCTAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 3879099-3880214	Sequence	W7S_17500 - alanine dehydrogenase
ORF... 3880243-3881268	Sequence	W7S_17505 - hypothetical protein (Protein is coded in complementary strand; from 3881268 to 3880243)