Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3911892
End position: 3911918
Length: 27

DNA sequence
>NC_017904, from 3911892 to 3911918 (27 bp); Mycobacterium sp. MOTT36Y TCGTCGGCGTCGTCGGCGTCGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3911754-3913145	Sequence	W7S_17660 - cobyrinic acid a,c-diamide synthase (Protein is coded in complementary strand; from 3913145 to 3911754)