Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3914684
End position: 3914707
Length: 24

DNA sequence
>NC_017904, from 3914684 to 3914707 (24 bp); Mycobacterium sp. MOTT36Y GGGTCGGGCTCGGGGTCCGGCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3913787-3915628	Sequence	W7S_17670 - chelatase (Protein is coded in complementary strand; from 3915628 to 3913787)