Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3928804
End position: 3928833
Length: 30

DNA sequence
>NC_017904, from 3928804 to 3928833 (30 bp); Mycobacterium sp. MOTT36Y AGCGCGGCGCAGCCGGGCGCAGCGCGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3928068-3928859	Sequence	W7S_17735 - hypothetical protein (Protein is coded in complementary strand; from 3928859 to 3928068)