Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3943246
End position: 3943272
Length: 27

DNA sequence
>NC_017904, from 3943246 to 3943272 (27 bp); Mycobacterium sp. MOTT36Y CGTCCTCGCCGGCCTCGCCGTCCTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3943143-3943700	Sequence	W7S_17805 frr ribosome recycling factor (Protein is coded in complementary strand; from 3943700 to 3943143)