Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 3981967
End position: 3981996
Length: 30

DNA sequence
>NC_017904, from 3981967 to 3981996 (30 bp); Mycobacterium sp. MOTT36Y CGGTCCCAGACCGGCCCAGACCGTCTCAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3981993-3982982	Sequence	W7S_17960 - hypothetical protein (Protein is coded in complementary strand; from 3982982 to 3981993)