Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 4005632
End position: 4005676
Length: 45

DNA sequence
>NC_017904, from 4005632 to 4005676 (45 bp); Mycobacterium sp. MOTT36Y GGCCGGCGTTTCGGGCGCCGGGGTCTCGGGCGCCGGGGTTTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4004691-4006016	Sequence	W7S_18080 - signal recognition particle-docking protein FtsY (Protein is coded in complementary strand; from 4006016 to 4004691)