Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 4065546
End position: 4065572
Length: 27

DNA sequence
>NC_017904, from 4065546 to 4065572 (27 bp); Mycobacterium sp. MOTT36Y CGGTCAGCTCGGCCAGCTCGGCCAGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4064486-4066354	Sequence	W7S_18365 - acetolactate synthase 1 catalytic subunit (Protein is coded in complementary strand; from 4066354 to 4064486)