Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 4233710
End position: 4233733
Length: 24

DNA sequence
>NC_017904, from 4233710 to 4233733 (24 bp); Mycobacterium sp. MOTT36Y CGTGGTGGTGGTGGTGGTCGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4233570-4234058	Sequence	W7S_19260 - hypothetical protein (Protein is coded in complementary strand; from 4234058 to 4233570)