Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 4576372
End position: 4576407
Length: 36

DNA sequence
>NC_017904, from 4576372 to 4576407 (36 bp); Mycobacterium sp. MOTT36Y CCGCGTGATTTTCCGCGTGATTTTCCGCGTGATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4576362-4577927	Sequence	W7S_20920 - hypothetical protein (Protein is coded in complementary strand; from 4577927 to 4576362)