Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 4641132
End position: 4641156
Length: 25

DNA sequence
>NC_017904, from 4641132 to 4641156 (25 bp); Mycobacterium sp. MOTT36Y CGGCGCGGCGCGCCGCAGCGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4640497-4641327	Sequence	W7S_21185 - hypothetical protein (Protein is coded in complementary strand; from 4641327 to 4640497)