Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 47676
End position: 47699
Length: 24

DNA sequence
>NC_017904, from 47676 to 47699 (24 bp); Mycobacterium sp. MOTT36Y CGGGGCCGTGGCGGGGGCCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 47530-48705	Sequence	W7S_00230 - hypothetical protein (Protein is coded in complementary strand; from 48705 to 47530)