Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 4814458
End position: 4814482
Length: 25

DNA sequence
>NC_017904, from 4814458 to 4814482 (25 bp); Mycobacterium sp. MOTT36Y GCCGCGCCGTGACGCCCCGCGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4814449-4815216	Sequence	W7S_22115 - enoyl-CoA hydratase (Protein is coded in complementary strand; from 4815216 to 4814449)