Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 4928725
End position: 4928751
Length: 27

DNA sequence
>NC_017904, from 4928725 to 4928751 (27 bp); Mycobacterium sp. MOTT36Y CGACGTCGTCGACGACGTCGACGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4928658-4929323	Sequence	W7S_22610 - hypothetical protein (Protein is coded in complementary strand; from 4929323 to 4928658)