Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 5063927
End position: 5063950
Length: 24

DNA sequence
>NC_017904, from 5063927 to 5063950 (24 bp); Mycobacterium sp. MOTT36Y ACGGCGGCGGCGACGACGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5059929-5064365	Sequence	W7S_23275 - putative metal cation transporting P-type ATPase