Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 5084335
End position: 5084358
Length: 24

DNA sequence
>NC_017904, from 5084335 to 5084358 (24 bp); Mycobacterium sp. MOTT36Y CGGAGGCGGCGGCGGGGGCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5084036-5084368	Sequence	W7S_23370 - hypothetical protein (Protein is coded in complementary strand; from 5084368 to 5084036)