Sequence retrieval

Genome: Mycobacterium sp. MOTT36Y
Start position: 5123699
End position: 5123722
Length: 24

DNA sequence
>NC_017904, from 5123699 to 5123722 (24 bp); Mycobacterium sp. MOTT36Y GCCGCCGTCGCCGCCGCCGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 5123343-5124482	Sequence	W7S_23575 - hypothetical protein (Protein is coded in complementary strand; from 5124482 to 5123343)